Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_103809 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | Link to database | PMID | 30720163 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | n/a |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward AAAGAGTTTTTGGAAGACGTC ReverseTGGTGGCATGTTTTGTCATT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Li, X, Shen, M (2019). Circular RNA hsa_circ_103809 suppresses hepatocellular carcinoma proliferation and invasion by sponging miR-620. Eur Rev Med Pharmacol Sci, 23, 2:555-566. |